Hepatitis B virus genotypes among chronic hepatitis B patients reporting at Korle-Bu teaching hospital, Accra, Ghana

Hepatitis B virus genotypes among chronic hepatitis B patients reporting at Korle-Bu teaching hospital, Accra, Ghana

 

Anthony Zunuo Dongdem^1,2,&, Mawuli Dzodzomenyo³, Richard Harry Asmah⁴, Kofi Mensah Nyarko¹, Priscillia Nortey¹, Adwoa Agyei⁵, David Nana Adjei⁴, Ernest Kenu¹, Andrew Anthony Adjei⁶

 

¹Ghana Field Epidemiology and Laboratory Training Program, School of Public Health, College of Health Sciences, University of Ghana, Legon, Ghana, ²Department of Epidemiology and Biostatistics, School of Public Health, University of Health and Allied Sciences, Ho, Volta Region, Ghana, ³Department of Biological, Environmental and Occupational Health, School of Public Health, College of Health Sciences, University of Ghana, Legon, Ghana, ⁴School of Biomedical and Allied Health Sciences, College of Health Sciences, Korle-Bu, Accra, Ghana, ⁵Department of Medicine, Korle-bu Teaching Hospital, Accra, Ghana, ⁶Department of Pathology, University of Ghana Medical School, College of Health Sciences, Korle-Bu, Accra, Ghana

 

 

^&Corresponding author
Anthony Zunuo Dongdem, Department of Epidemiology & Biostatistics, School of Public Health, University of Health and Allied Sciences, Accra, Ghana

 

 

 

 

Hepatitis B virus is a DNA virus and the most common among the hepatitis viruses that cause chronic infections in humans. About two billion people globally have been exposed to HBV with approximately 5% of the world's populations (350 million people) being chronic carriers [1], of which about 500,000-1.2 million hepatocellular carcinoma (HCC) associated deaths occur annually[2,3]. HBV is classified into eight genotypes (A to H) based on a sequence divergence of more than 8% throughout the genome [4]. Two additional genotypes (I and J) have recently been proposed in Asia [5,6]. The diversity among the genotypes has led to the division of some genotypes into sub-genotypes [7]. Each of these genotypes has a distinct geographical distribution between and within regions [8]. For instance genotype A is predominant in Sub-Saharan Africa, genotypes B and C in South East Asia, genotype D in Africa and Mediterranean countries, genotype E in Western and Central Africa, genotypes F and H in Central and South America, genotype G in North America [8-10].

 

HBV infection is emerging in Ghana and autopsy reports have revealed HBV infection to be a major risk factor for developing liver cirrhosis and HCC [11]. Knowledge about the infecting HBV genotypes has proven useful in understanding disease progression and response to antiviral treatment [12]. In Ghana, very little information is available on the circulating HBV genotypes. Chronic hepatitis B patients who meet the treatment criteria are being treated with variable response. The aim of this study was to determine the circulating HBV genotypes among chronic hepatitis B patients reporting at the Korle-Bu Teaching Hospital (KBTH), Accra, Ghana. Information from this current study will help in understanding the molecular epidemiology of the virus and possibly provide guidance to clinicians in the management of chronic hepatitis B patients in future.

 

 

 

Study design

 

This cross sectional study was carried out among chronic hepatitis B patients reporting at the KBTH from October 2009 to June 2010.

 

Study site description

 

The study was conducted at the Gastroenterology Unit and the Central Laboratory of the KBTH, Accra, Ghana. The KBTH is situated in the nation's capital, Accra, and it is the leading tertiary hospital and a major referral centre in the country. The Gastroenterology Unit is the biggest tertiary care for hepatitis cases in the country. More than 70% of the total cases in the country receive care and treatment at the Unit.

 

Study population

 

The study subjects were chronic hepatitis B patients. Chronicity of the patients was determined based on their hepatitis B profile data (HBcIgM-negative and HBcIgG-positive). Patients on antiviral therapy for hepatitis B infection and those reporting on repeated visits were excluded from the study. A structured questionnaire was used to obtain socio-demographic characteristics of the subjects after which a blood sample was collected from each participant.

 

Ethical clearance

 

Permission was sought from the KBTH authorities and approval granted by the Research and Ethical Review Committee of the Ghana Health Service. Informed consent was also obtained from patients or guardian of the patients before enrollment into the study. Patient's confidentiality was assured by allocating identity numbers.

 

Sample collection and storage

 

Blood samples (10ml) were collected from each of the consenting patients in EDTA tubes. Samples were centrifuged and serum kept at -20^oC until analyzed.

 

Laboratory analysis

 

Genomic DNA extraction

 

Total DNA was extracted from plasma of all HBsAg positive kit using the QIAamp DNA Mini kit (Qiagen Co. Ltd UK) in accordance with the manufacturer's instructions.

 

Polymerase chain reaction (PCR) analysis

 

PCR detection of HBV DNA used was based on the protocol described previously [13].The primers used, 5`GTGGTGGACTTCTCTCAATTTTC 3` (forward) and 5`CGGTATAAAGGGACTCACGAT 3` (reverse), flank specifically the S region of the HBV genome. PCR core kit (BioPioneers) was used. PCR was carried out in 25 µl reaction volumes containing 2.0 µl of 10X PCR buffer, 1.5 µl of 25 mM MgCl2, 0.5 µl of 10 mM each of deoxyribonucleoside triphosphate (dNTPs), 0.5 µl of 10 mM of each oligonucleotide primer (Sigma- Aldrich., USA) 0.5 U of DNA Taq polymerase enzyme (Sigma- Aldrich., USA) . Ten microlitres (10 µl) of extracted DNA was used as template. Each reaction was thoroughly mixed by vortexing and flush centrifuged. The conditions used in the PCR amplification were initial denaturation at 94^oC for 3 minutes, followed by 40 cycles of denaturation at 94^oC for 45 seconds, annealing at 53^oC for 60 seconds and extension at 72^oC for 90 seconds. This was then followed by one cycle of 72^oC for 7 minutes [13] using a GeneAmp PCR System 2400 thermal cycler (Perkin Elmer, Norwalk CA, USA). The presence of HBV DNA was detected by running the PCR product on 2% agarose gel containing 0.5 µg/ml ethidium bromide.

 

Restriction fragment length polymorphism (RFLP) analysis

 

PCR positive products obtained were doubly digested with Hinfl and Tsp5091 (New England BioLabs) restriction enzymes. The HinfI reaction had a total digestion reaction of 15.0 µl containing1.5 µl of X10 buffer, 3.0 µl of nuclease-free water, 0.50 µl of the enzymes and 10 µl of the PCR product. This was incubated at 37^oC for three hours. The Tsp509I reaction also had a total reaction volume of 15.0 µl containing10 µl of PCR products, 1.5 µl of X10 buffer, 2.5 µl of nuclease free water and 1.0 µl of the enzyme. This was also incubated at 65^oC for 3 hours. Ten microlitres of PCR product was mixed with1.5 µl of X10 buffer and 3.5 µl of nuclease free water but no restriction enzymes were run parallel with the enzyme treated sample as controls. The reactions were terminated by adding 4 µl of the loading buffer. A 3% agarose gel containing 0.5 µg/ml ethidium bromide was used to separate the restriction fragment length polymorphism (RFLP) products.

 

Statistical analysis

 

Data was entered in Excel and statistical analysis was carried out using STATA (version 10.0) statistical packages. For socio demographic categorical data (e.g sex), summary tables of counts and percentages were presented. For socio demographic continuous data (e.g. age), summary tables of means, standard deviations were presented. Pearson's chi square test and Fisher's exact test were used to establish associations between demographic data and various outcome variables. All statistical tests were conducted as two-sided and declared significant for p-value < 0.05.

 

 

 

Characteristic of the subjects

 

Two hundred and fifty (250) chronic hepatitis B patients were enrolled. The participants were 91 (36.4%) males aged 33±12.1 years and 159 (63.6%) females aged 29.3±9.1 years. (Table 1) shows HBV DNA detection by age and sex in the studied population. HBV DNA was detected in 111 (44.4%) of the 250 patients screened by PCR. We found that more males 44 out of 91 (48.4%) were frequently infected than females 67 out of 159 (42.1%). This was however not significant (X²=0.905; p-value=0.341). We also found that HBV infection to be highest (60%) in both the younger age group (10 - 19 years) and in the older age group of greater than 59 years and the lowest was found in age group 50 - 59 years. These differences were not significant (X²=5.35; p-value=0.500). (Figure 1) shows the gel electrophoresis pattern for HBV PCR positive samples.

 

HBV genotype distribution

 

Out of a total of 111 samples that tested positive for HBV DNA only 58 (52.2%) showed genotype specific bands. The remaining 53 (47.7%) were untypeableas no genotype-specific band were seen. The distribution of the typeable genotypes is as follows: genotype A accounted for 8 (7.2%), genotype D, 3 (2.7%) genotype E, 47 (42.3%). The untypeable accounted for 53 (47.7%).The gel electrophoresis pattern for HBV genotypes obtained after restriction enzyme digest is shown (Figure 2). The predominant genotype of the study was E. The predominant genotype among males was E, 21(47.7%), followed by A, 4(9.1%). Similarly among females the predominant infecting genotype was E, 26(38.8%) followed by A 4(6.0%). Genotype D was the least typed in both sexes. Although there were differences in the proportion of the infecting genotype and gender of the patient, this was not significant (x²=0.283, p=0.579). Genotype A and E were predominant in the young patients ages between 20 - 29 years, and genotype D ages between (0 - 9 years), (20 - 29 years) and (30 - 39 years). However, genotypes were absent from individuals aged more than 59 years. This relationship between age and the infecting genotype was however found to be non-significant (X²=0.923; p-value=0.623).No mixed genotypes were found among the study subjects. The distribution of the HBV genotype by age and sex is shown (Table 2).

 

 

HBV is endemic in Ghana although there is scarcity of information on HBV genotypes. This study is the first conducted in Southern Ghana profiling the genotypic status of HBV among chronic hepatitis B patients in Ghana.The results of the study revealed that the circulating genotypes were A, D and E.This is in agreement with a study conducted among blood donors by Valente and colleagues in Angola who similarly reported the prevalence of genotypes A, D and E [14]. The findings are also in consonance with an earlier study in Ghana among blood donors at Komfo Anokye Teaching Hospital in Kumasi which similarly detected the prevalence of genotypes A, D and E [10]. These findings suggest that the genotypes present in blood donors are similar to those among chronic hepatitis B patients. In Africa, genotype A is prevalent in Southern Africa and genotype D in Northern Africa [15,16]. In our study genotype E was found to be the most prevalent. This is consistent with other studies in West Africa which confirm genotype E predominance in West Africa [9,10,17,18]. This findings further support the idea that genotype E is located in West Africa and common among African descendants [4,9]. Many studies have revealed the severity and outcomes of disease to these genotypes; genotype C and D are thought to be more virulent in chronic carriers developing liver cirrhosis and HCC than genotypes A and B [19,20]. It has also been reported by Flink and colleagues that genotype A response better to interferon alpha and pegylated interferon alpha than genotype D [21].Thus the presence of these genotypes in our study population carries some important implication as regards disease progression and therapy. The clinical implication of genotype E has not been well studied [22,23] although Fujiwara and colleagues speculated that HBV genotype E has a better prognosis than other genotypes in terms of liver disease [18].

 

In our study we could not detect minor subgenotypes and recombinant genotypes because the RFLP technique employed is less sensitive compared to the gold standard genome sequencing technique [24,25]. This may account for the 47.7% of untypeables. Other studies using RFLP technique similarly reported untypeables [26]. These untypeables may represent novel, minor subgenotypes and recombinant genotypes in our study subjects. We also assessed the genotype distribution with respect to age and gender of patients. Genotype A and E were predominant in the younger patients less than 39 years and absent in the older age group (more than 59 years). This suggests that infections with these genotypes occur much earlier in life but contrasts the study in Pakistan among hepatitis B patients where no trend was found [26]. Our findings however agrees with a similar trend in a study in Japan, where genotype B presence increased from teenage to 50 years and genotype C, decreased from teenage to 50 years respectively [27]. The differences we detected were not significant and may only be a reflection of the age group in which majority of the samples were drawn. In terms of the infecting genotype and gender, genotype E was the most prevalent followed by genotype A in both males and females. These findings are in consonance with those of You et al among chronic HBV-infected patients in Yunnan, China [28] and contrasts the study by Yoshikawa who found genotype A mostly in male Japanese blood donors [27]. The study also demonstrated HBV DNA detection to be higher in males than females suggesting that more males with chronic hepatitis B were potentially more infectious than their female counterparts. Other studies have similarly suggested infections rates to be higher in males than females [29]. It is not clear how this happens but could be attributed to the chromosomal and endocrinal differences between males and females since males and females could have the same rate of exposure. In most HBV endemic Asian countries a lot of studies have been done to understand the molecular dynamics of HBV and its implication in the disease progression and management, our study is a step to determining the genotypes circulating among chronic hepatitis B patients, in Ghana. Future research needs be done in our country to better understand the molecular dynamics of HBV, since genotypes differ by geographical location [8, 10].

 

 

Our study has shown the major circulating hepatitis B genotypes among chronic hepatitis B patients reporting to KBTH, Accra to be genotype A, D and E, with genotype E being the predominant. We recommend researchers to conduct similar studies using genome sequencing and further phylogenetic analysis to establish the existence of the minor/subgenotypes or recombinant or novel genotypes and also to determine the effect of these genotypes in the management of chronic hepatitis patients in Ghana.

 

 

The authors declare no competing interest.

 

 

Anthony Zunuo Dongdem: conceived the study, designed the study, collected the samples, carried out the molecular genotyping studies and drafted the manuscript, Mawuli Dzodzomenyo: participated in the design and review of the manuscript. Richard Harry Asmah: participated in the design, participated in carrying out the molecular genotyping studies and drafted the manuscript. Priscillia Nortey: contributed in drafting of the manuscript and reviewing it for intellectual content. Kofi Mensah Nyarko: contributed to the drafting of the manuscript and reviewed it critically for intellectual content. Adwoa Agyei: responsible for the clinical diagnosis of patients and aided in the clinical data collection. Ernest Kenu: involved in data analysis and the drafting and reviewing of manuscript. David Nana Adjei: participated and drafted the manuscript and performed the statistical analysis. Andrew Anthony Adjei: participated in the design and reviewing of the manuscript. All authors have read and agreed to the final version of this manuscript and have equally contributed to its content and to the management of the case.

 

 

We want to acknowledge the financial support from the Graduate School of the University of Ghana and the research grant awarded to us by the College of Health Sciences, University of Ghana for the completion of this work. We are highly indebted to the Korle-bu Teaching Hospital authorities especially Dr. Francis Ofei, Head of Department of Medicine, Mr. Augustine Sagoe, Laboratory manager of KBTH Central Laboratory and his technical staff for their support during the collection of the samples. We are also thankful to Prof. Edwin Wiredu, Dean of the School of Allied Health Sciences for allowing us to use his molecular laboratory for this work. Last but not the least to the Ghana Field Epidemiology and Laboratory Training Programme (GFELTP) former Director Dr. Frederick Wurapa, Coordinator Prof. Edwin Afari and lecturers Dr. Samuel Sackey, Dr. Simon Antara as well as the secretariat staff Ms. Gladys Antwi.

 

 

Table 1: HBV DNA detection by age and sex among chronic hepatitis B patients

Table 2: pattern of HBV genotype among chronic hepatitis B patients by age and sex

Figure 1: shows gel electrophoresis pattern for HBV PCR positive samples. Lane M, 100bp molecular base marker, lanes 1-23 are with HBV DNA [540bp]

Figure 2: shows the outcome of the RFLP of the S gene amplicon that was analyzed. Gel electrophoresis pattern for HBV genotypes obtained after restriction enzymes digest with Hinf 1 and Tsp 5091. Lane M, 100bp molecular base marker, the combination of lanes 4, 6, 8,10, 12 and 14 are one pattern (genotype A), the combination of lanes 3 and 11 are of one pattern (genotype D), the combination of lanes 5, 7, 9 and 13 are of another pattern (genotype E)

 

 

1. Zuckerman JN, Zuckerman AJ. Current Topics in Hepatitis B. J Infect. 2000; 41(2):130-6. PubMed | Google Scholar


2. Lavanchy D. Worldwide epidemiology of HBV infection, disease burden, and vaccine prevention. J Clin Virol Off Publ Pan Am Soc Clin Virol. 2005; 34 Suppl 1:S1-3. PubMed | Google Scholar


3. Rimseliene G, Nilsen Ø, Kløvstad H et al. Epidemiology of acute and chronic hepatitis B virus infection in Norway, 1992-2009. BMC Infect Dis. 2011; 11(1):153. PubMed | Google Scholar


4. Norder H, Couroucé A-M, Coursaget P et al. Genetic diversity of hepatitis B virus strains derived worldwide: genotypes, subgenotypes, and HBsAg subtypes. Intervirology. 2004; 47(6):289-309. PubMed | Google Scholar


5. Olinger CM, Jutavijittum P, Hübschen JM et al. Possible New Hepatitis B Virus Genotype, Southeast Asia. Emerg Infect Dis. 2008; 14(11):1777-80. PubMed | Google Scholar


6. Tatematsu K, Tanaka Y, Kurbanov F et al. A genetic variant of hepatitis B virus divergent from known human and ape genotypes isolated from a Japanese patient and provisionally assigned to new genotype J. J Virol. 2009; 83(20):10538-47. PubMed | Google Scholar


7. Araujo NM, Waizbort R, Kay A. Hepatitis B virus infection from an evolutionary point of view: How viral, host, and environmental factors shape genotypes and subgenotypes. Infect Genet Evol. 2011; 11(6):1199-207. PubMed | Google Scholar


8. Norder H, Couroucé A-M, Coursaget P et al. Genetic diversity of hepatitis B virus strains derived worldwide: genotypes, subgenotypes, and HBsAg subtypes. Intervirology. 2004; 47(6):289-309. PubMed | Google Scholar


9. Bekondi C, Olinger CM, Boua N et al. Central African Republic is part of the West-African hepatitis B virus genotype E crescent. J Clin Virol. 2007; 40(1):31-7. PubMed | Google Scholar


10. Candotti D, Opare-Sem O, Rezvan H et al. Molecular and serological characterization of hepatitis B virus in deferred Ghanaian blood donors with and without elevated alanine aminotransferase. J Viral Hepat. 2006; 13(11):715-24. PubMed | Google Scholar


11. Wiredu EK, Armah HB. Cancer mortality patterns in Ghana: a 10-year review of autopsies and hospital mortality. BMC Public Health. 2006; 6(1):159. PubMed | Google Scholar


12. Sunbul M. Hepatitis B virus genotypes: Global distribution and clinical importance. World J Gastroenterol WJG. 2014; 20(18):5427-34. PubMed | Google Scholar


13. Lindh M, Andersson AS, Gusdal A. Genotypes, nt 1858 variants, and geographic origin of hepatitis B virus--large-scale analysis using a new genotyping method. J Infect Dis. 1997; 175(6):1285-93. PubMed | Google Scholar


14. Valente F, Lago BV do, Castro CAV de et al. Epidemiology and molecular characterization of hepatitis B virus in Luanda, Angola. Mem Inst Oswaldo Cruz. 2010; 105(8):970-7. PubMed | Google Scholar


15. Kimbi GC, Kramvis A, Kew MC. Distinctive sequence characteristics of subgenotype A1 isolates of hepatitis B virus from South Africa. J Gen Virol. 2004; 85(5):1211-20. PubMed | Google Scholar


16. Saudy N, Sugauchi F, Tanaka Y et al. Genotypes and phylogenetic characterization of hepatitis B and delta viruses in Egypt. J Med Virol. 2003; 70(4):529-36.. PubMed | Google Scholar


17. Mulders MN, Venard V, Njayou M et al. Low Genetic Diversity despite Hyperendemicity of Hepatitis B Virus Genotype E throughout West Africa. J Infect Dis. 2004; 190(2):400-8. PubMed | Google Scholar


18. Fujiwara K. Distribution of HBV genotypes among HBV carriers in Benin: phylogenetic analysis and virological characteristics of HBV genotype E. Age Yr. 2005; 21:2-21. PubMed | Google Scholar


19. Shi Y-H. Correlation between hepatitis B virus genotypes and clinical outcomes. Jpn J Infect Dis. 2012; 65(6):476-82. PubMed | Google Scholar


20. Fung SK, Lok ASF. Hepatitis B virus genotypes: do they play a role in the outcome of HBV infection?. Hepatol Baltim Md. 2004; 40(4):790-2. PubMed | Google Scholar


21. Flink HJ, van Zonneveld M, Hansen BE et al. Treatment with Peg-interferon alpha-2b for HBeAg-positive chronic hepatitis B: HBsAg loss is associated with HBV genotype. Am J Gastroenterol. 2006; 101(2):297-303. PubMed | Google Scholar


22. Liu C-J, Kao J-H. Clinical implications of hepatitis B virus genotype. Hepatol Rev. 2006; 3:33-40. PubMed | Google Scholar


23. Candotti D, Danso K, Allain J-P. Maternofetal transmission of hepatitis B virus genotype E in Ghana, west Africa. J Gen Virol. 2007; 88(10):2686-95. PubMed | Google Scholar


24. Valsamakis A. Molecular testing in the diagnosis and management of chronic hepatitis B. Clin Microbiol Rev. 2007; 20(3):426-39, table of contents. PubMed | Google Scholar


25. Bartholomeusz A, Schaefer S. Hepatitis B virus genotypes: comparison of genotyping methods. Rev Med Virol. 2004; 14(1):3-16. PubMed | Google Scholar


26. Alam MM, Zaidi SZ, Malik SA et al. Molecular epidemiology of Hepatitis B virus genotypes in Pakistan. BMC Infect Dis. 2007; 7(1):115. PubMed | Google Scholar


27. Yoshikawa A, Gotanda Y, Suzuki Y et al. Age- and gender-specific distributions of hepatitis B virus (HBV) genotypes in Japanese HBV-positive blood donors. Transfusion (Paris). 2009; 49(7):1314-20. PubMed | Google Scholar


28. You J, Sriplung H, Chongsuvivatwong V et al. Profile, spectrum and significance of hepatitis B virus genotypes in chronic HBV-infected patients in Yunnan, China. Hepatobiliary Pancreat Dis Int HBPD INT. 2008; 7(3):271-9. PubMed | Google Scholar


29. Baig S. Gender Disparity in Infections of Hepatitis B Virus. jcpsp. 2009; 19(9):598-600. PubMed | Google Scholar